spoar

SPOA is a C++ library for fast alignment and consensus generation of closely related sequences, especially used for long, error-containing reads from third generation sequencers. It allows local, global, and semi-global (overlap) alignment, using linear, affine, or convex gap penalties, and can also weight by quality scores. SPOAR is an R wrapper for SPOA.

Installation instructions

Get the latest stable R release from CRAN. Then install spoar using from Bioconductor the following code:

if (!requireNamespace("BiocManager", quietly = TRUE)) {
    install.packages("BiocManager")
}

BiocManager::install("spoar")

And the development version from GitHub with:

BiocManager::install("brendanf/spoar")

Example

Here is the first basic example from the SPOR README:

library("spoar")

sequences <- c(
    "CATAAAAGAACGTAGGTCGCCCGTCCGTAACCTGTCGGATCACCGGAAAGGACCCGTAAAGTGATAATGAT",
    "ATAAAGGCAGTCGCTCTGTAAGCTGTCGATTCACCGGAAAGATGGCGTTACCACGTAAAGTGATAATGATTAT",
    "ATCAAAGAACGTGTAGCCTGTCCGTAATCTAGCGCATTTCACACGAGACCCGCGTAATGGG",
    "CGTAAATAGGTAATGATTATCATTACATATCACAACTAGGGCCGTATTAATCATGATATCATCA",
    "GTCGCTAGAGGCATCGTGAGTCGCTTCCGTACCGCAAGGATGACGAGTCACTTAAAGTGATAAT",
    "CCGTAACCTTCATCGGATCACCGGAAAGGACCCGTAAATAGACCTGATTATCATCTACAT"
)

spoaAlign(sequences)
#> [1] "CATAAAAGAACG------T---------AGGTCGCCCGTCCGTAACC-T-GTCG-G-ATCACCGG-AA-A--G-G--A-CC-CGTAAAGTGATAATGAT-------------"
#> [2] "------------------------ATAAAGGCAGTCGCTCTGTAAGC-T-GTCG-A-TTCACCGGAAAGATGGCGTTA-CCACGTAAAGTGATAATGATTAT----------"
#> [3] "-ATCAAAGAACG------T-----------GTAGCCTGTCCGTAATC-T-AGCGCATTTCACACG--AGA---C-----CCGCGTAATGGG---------------------"
#> [4] "------------CGTAAAT---------AGGTAAT-GAT-TATCAT--T-A-C--ATATCACAAC--T-A--G-G----GC-CGT-AT-TAATCATGA-TATCATCA-----"
#> [5] "-------------------GTCGC-TAGAGGCA-T-CGTGAGTC-GC-T--TCC-G--T-ACCGCAAGGATGACG--AGTCACTTAAAGTGATAAT----------------"
#> [6] "---------------------------------------CCGTAACCTTCATCG-G-ATCACCGG-AA-A--G-G--A-CC-CGTAAA-TAGACCTGATTATCATC-TACAT"

spoaConsensus(sequences)
#> [1] "CATCAAAGAACGTAGGTAGCCCGTCCGTAACCTGTCGGATCACCGGAAAGAGGACCCGTAAAGTGATAATGATTATCATCTACAT"

Citation

Below is the citation output from using citation('spoar') in R. Please run this yourself to check for any updates on how to cite spoar.

print(citation("spoar"), bibtex = TRUE)
#> 
#> Furneaux B, Vaser R (2021). _SPOAR: SIMD Partial Order Alignment in R_.
#> doi: 10.18129/B9.bioc.spoar (URL:
#> https://doi.org/10.18129/B9.bioc.spoar),
#> https://github.com/brendanf/spoar/spoar - R package version 0.99.3,
#> <URL: http://www.bioconductor.org/packages/spoar>.
#> 
#> A BibTeX entry for LaTeX users is
#> 
#>   @Manual{,
#>     title = {SPOAR: SIMD Partial Order Alignment in R},
#>     author = {Brendan Furneaux and Robert Vaser},
#>     year = {2021},
#>     url = {http://www.bioconductor.org/packages/spoar},
#>     note = {https://github.com/brendanf/spoar/spoar - R package version 0.99.3},
#>     doi = {10.18129/B9.bioc.spoar},
#>   }
#> 
#> Vaser R, Sović I, Nagaranjan N, Šikić M (2017). "Fast and accurate de
#> novo genome assembly from long uncorrected reads." _Genome Research_,
#> *27*, 737-746. doi: 10.1101/gr.214270.116 (URL:
#> https://doi.org/10.1101/gr.214270.116), <URL:
#> https://doi.org/10.1101/gr.214270.116>.
#> 
#> A BibTeX entry for LaTeX users is
#> 
#>   @Article{,
#>     title = {Fast and accurate de novo genome assembly from long uncorrected reads},
#>     author = {Robert Vaser and Ivan Sović and Niranjan Nagaranjan and Mile Šikić},
#>     year = {2017},
#>     journal = {Genome Research},
#>     volume = {27},
#>     issue = {5},
#>     pages = {737--746},
#>     doi = {10.1101/gr.214270.116},
#>     url = {https://doi.org/10.1101/gr.214270.116},
#>   }

Please note that the spoar was only made possible thanks to many other R and bioinformatics software authors, which are cited either in the vignettes and/or the paper(s) describing this package.

Code of Conduct

Please note that the spoar project is released with a Contributor Code of Conduct. By contributing to this project, you agree to abide by its terms.

Development tools

• Continuous code testing is possible thanks to GitHub actions through usethis, remotes, and rcmdcheck customized to use Bioconductor’s docker containers and BiocCheck.
• Code coverage assessment is possible thanks to codecov and covr.
• The documentation website is automatically updated thanks to pkgdown.
• The code is styled automatically thanks to styler.
• The documentation is formatted thanks to devtools and roxygen2.

For more details, check the dev directory.

This package was developed using biocthis.